ID: 1105070403_1105070422

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1105070403 1105070422
Species Human (GRCh38) Human (GRCh38)
Location 12:133231134-133231156 12:133231183-133231205
Sequence CCACCTGCCCTCCATCTCCACTG GCCAGTCCCTGGGTGGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 111, 4: 875} {0: 1, 1: 0, 2: 2, 3: 28, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!