|
Left Crispr |
Right Crispr |
| Crispr ID |
1105167496 |
1105167498 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:17535452-17535474
|
13:17535484-17535506
|
| Sequence |
CCTCTCTTTTGAAGCAGCAGTTT |
CTTTTTGTAGAAACTGTAAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 248, 2: 360, 3: 10349, 4: 22372} |
{0: 396, 1: 5054, 2: 20936, 3: 64029, 4: 78433} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|