|
Left Crispr |
Right Crispr |
| Crispr ID |
1105188652 |
1105188654 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:17865178-17865200
|
13:17865197-17865219
|
| Sequence |
CCTCTCTTTTGAAGCAGCAGTTT |
GTTTGGAAACACTCTTTTTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 248, 2: 360, 3: 10349, 4: 22372} |
{0: 852, 1: 15428, 2: 21522, 3: 15418, 4: 20342} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|