ID: 1105201000_1105201004

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1105201000 1105201004
Species Human (GRCh38) Human (GRCh38)
Location 13:18177613-18177635 13:18177656-18177678
Sequence CCATTGACCATCCTTTTACTGTC GCTTTCTGCACTCAGCTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 287} {0: 7, 1: 0, 2: 4, 3: 16, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!