ID: 1105214010_1105214011

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1105214010 1105214011
Species Human (GRCh38) Human (GRCh38)
Location 13:18273947-18273969 13:18273960-18273982
Sequence CCTGCTGGGGAGGAAGAGACAGA AAGAGACAGACTTGTCTGCCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 5, 3: 53, 4: 681} {0: 2, 1: 1, 2: 0, 3: 14, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!