ID: 1105214910_1105214919

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1105214910 1105214919
Species Human (GRCh38) Human (GRCh38)
Location 13:18278364-18278386 13:18278415-18278437
Sequence CCGAAGCCTCTAAGCCCTCAGAT CAGAATTGTCACTCTTAGCAAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 20, 4: 166} {0: 2, 1: 2, 2: 2, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!