ID: 1105214914_1105214919

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1105214914 1105214919
Species Human (GRCh38) Human (GRCh38)
Location 13:18278379-18278401 13:18278415-18278437
Sequence CCTCAGATCAAGGTCCACACATG CAGAATTGTCACTCTTAGCAAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 1, 3: 9, 4: 131} {0: 2, 1: 2, 2: 2, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!