ID: 1105215228_1105215236

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1105215228 1105215236
Species Human (GRCh38) Human (GRCh38)
Location 13:18280300-18280322 13:18280324-18280346
Sequence CCCCCTGGGCTCCATACCCTTCC CAGCACCCTCTATATATCTCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 4, 3: 40, 4: 378} {0: 3, 1: 0, 2: 1, 3: 45, 4: 1334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!