ID: 1105219465_1105219476

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1105219465 1105219476
Species Human (GRCh38) Human (GRCh38)
Location 13:18312326-18312348 13:18312346-18312368
Sequence CCCCCATCCATCTCCTGCAAAGA AGAAGGCTGGAGGCAGGTCAGGG
Strand - +
Off-target summary {0: 7, 1: 1, 2: 1, 3: 25, 4: 269} {0: 7, 1: 0, 2: 5, 3: 64, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!