ID: 1105219467_1105219475

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1105219467 1105219475
Species Human (GRCh38) Human (GRCh38)
Location 13:18312328-18312350 13:18312345-18312367
Sequence CCCATCCATCTCCTGCAAAGAAG AAGAAGGCTGGAGGCAGGTCAGG
Strand - +
Off-target summary {0: 7, 1: 1, 2: 0, 3: 20, 4: 207} {0: 7, 1: 0, 2: 5, 3: 37, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!