ID: 1105221067_1105221070

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1105221067 1105221070
Species Human (GRCh38) Human (GRCh38)
Location 13:18327962-18327984 13:18328005-18328027
Sequence CCCATGCTTTGGAATGGGGTGAC AAATTCAAATTTGTGTGCATAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 9, 4: 110} {0: 4, 1: 2, 2: 1, 3: 36, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!