ID: 1105242854_1105242863

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1105242854 1105242863
Species Human (GRCh38) Human (GRCh38)
Location 13:18622931-18622953 13:18622967-18622989
Sequence CCTGCAGAACCAAGGGTGTGGGG GGTGGTGGTTGTTCAGCAAAGGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 2, 3: 20, 4: 261} {0: 5, 1: 2, 2: 2, 3: 14, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!