ID: 1105251687_1105251690

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1105251687 1105251690
Species Human (GRCh38) Human (GRCh38)
Location 13:18704421-18704443 13:18704449-18704471
Sequence CCACCAGTTTTCAGGAGAGATCC AGTTTCAATTAAGCTAAACACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 147} {0: 3, 1: 0, 2: 0, 3: 18, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!