ID: 1105255816_1105255822

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1105255816 1105255822
Species Human (GRCh38) Human (GRCh38)
Location 13:18743565-18743587 13:18743607-18743629
Sequence CCACATCTGAAGTGGGACTCCCT CTACAGATGGAAGAATGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 19, 4: 119} {0: 4, 1: 0, 2: 2, 3: 22, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!