ID: 1105271042_1105271050

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1105271042 1105271050
Species Human (GRCh38) Human (GRCh38)
Location 13:18875477-18875499 13:18875510-18875532
Sequence CCGTGAATAGTGCAGCCACGGAT CCCAACCCGCTCCCCACGATGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 6, 3: 6, 4: 52} {0: 4, 1: 1, 2: 2, 3: 24, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!