ID: 1105274425_1105274434

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1105274425 1105274434
Species Human (GRCh38) Human (GRCh38)
Location 13:18906330-18906352 13:18906358-18906380
Sequence CCAGCAGTTCCTGGCCAGCTGGA CCAGGGGCCGGTTTCAGCAAAGG
Strand - +
Off-target summary {0: 3, 1: 7, 2: 4, 3: 43, 4: 506} {0: 1, 1: 2, 2: 47, 3: 26, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!