ID: 1105278374_1105278379

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105278374 1105278379
Species Human (GRCh38) Human (GRCh38)
Location 13:18949148-18949170 13:18949163-18949185
Sequence CCAATGCCACCTCCCGGGCCCTG GGGCCCTGTCTCAGACACACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 368} {0: 1, 1: 0, 2: 0, 3: 26, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!