ID: 1105280734_1105280744

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1105280734 1105280744
Species Human (GRCh38) Human (GRCh38)
Location 13:18961138-18961160 13:18961179-18961201
Sequence CCCATCCTGGGCACTTCCCTCTG CTTCACATTTAGGGAGCAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 322} {0: 1, 1: 1, 2: 1, 3: 18, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!