ID: 1105284509_1105284514

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1105284509 1105284514
Species Human (GRCh38) Human (GRCh38)
Location 13:18993437-18993459 13:18993454-18993476
Sequence CCTGGAGTTCCAGAAAGCCAGGA CCAGGAGGCCAGAAGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 753} {0: 1, 1: 2, 2: 14, 3: 117, 4: 793}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!