ID: 1105291266_1105291270

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1105291266 1105291270
Species Human (GRCh38) Human (GRCh38)
Location 13:19055251-19055273 13:19055270-19055292
Sequence CCTCCTCAGTGAGAATCCCACAG ACAGAATCAGCTCCTTTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 179} {0: 1, 1: 0, 2: 6, 3: 84, 4: 755}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!