ID: 1105303471_1105303473

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1105303471 1105303473
Species Human (GRCh38) Human (GRCh38)
Location 13:19154237-19154259 13:19154261-19154283
Sequence CCAGGCAGCAGCTGGGTGGGACT GCTCTTCCCACGTCCCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 5, 3: 34, 4: 336} {0: 2, 1: 0, 2: 1, 3: 11, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!