ID: 1105303854_1105303863

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1105303854 1105303863
Species Human (GRCh38) Human (GRCh38)
Location 13:19155938-19155960 13:19155987-19156009
Sequence CCTCCCAAGTGTGTGCAGAAAGC GACCTGGAATTCCAGCACTTTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 17, 4: 156} {0: 1, 1: 36, 2: 4487, 3: 99061, 4: 327460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!