ID: 1105325154_1105325160

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1105325154 1105325160
Species Human (GRCh38) Human (GRCh38)
Location 13:19364174-19364196 13:19364195-19364217
Sequence CCCAGCCTCAGGAGACTGAGGTG TGGGAGGATTGCTTGAAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 111, 4: 589} {0: 207, 1: 2845, 2: 15665, 3: 43873, 4: 122020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!