ID: 1105325154_1105325162

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1105325154 1105325162
Species Human (GRCh38) Human (GRCh38)
Location 13:19364174-19364196 13:19364204-19364226
Sequence CCCAGCCTCAGGAGACTGAGGTG TGCTTGAAGCCAGGAGGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 111, 4: 589} {0: 2, 1: 325, 2: 10247, 3: 47503, 4: 108808}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!