ID: 1105342548_1105342550

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1105342548 1105342550
Species Human (GRCh38) Human (GRCh38)
Location 13:19541030-19541052 13:19541046-19541068
Sequence CCTTTTTAAAACTTAGTGTCCTC TGTCCTCTTCTAAGCTCAGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 44, 4: 442} {0: 2, 1: 1, 2: 3, 3: 31, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!