ID: 1105378142_1105378149

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1105378142 1105378149
Species Human (GRCh38) Human (GRCh38)
Location 13:19863458-19863480 13:19863488-19863510
Sequence CCGCCTCCTCCTCCGGAGGCTGC CCAGCCACCCCCACTCTCAGCGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 17, 3: 122, 4: 867} {0: 1, 1: 1, 2: 5, 3: 34, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!