ID: 1105378145_1105378149

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1105378145 1105378149
Species Human (GRCh38) Human (GRCh38)
Location 13:19863467-19863489 13:19863488-19863510
Sequence CCTCCGGAGGCTGCGCTGCTCCC CCAGCCACCCCCACTCTCAGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 25, 4: 213} {0: 1, 1: 1, 2: 5, 3: 34, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!