ID: 1105395864_1105395868

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1105395864 1105395868
Species Human (GRCh38) Human (GRCh38)
Location 13:20033806-20033828 13:20033830-20033852
Sequence CCATGATACATCTGTTACTATTA GGTGTGTGGTAGGAATGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 195} {0: 1, 1: 0, 2: 2, 3: 33, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!