ID: 1105408617_1105408622

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1105408617 1105408622
Species Human (GRCh38) Human (GRCh38)
Location 13:20151468-20151490 13:20151512-20151534
Sequence CCCCCATGCTGGCGGGAAGTCAC GTGTCAGACTCCCGATACCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97} {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!