ID: 1105409810_1105409812

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105409810 1105409812
Species Human (GRCh38) Human (GRCh38)
Location 13:20161690-20161712 13:20161705-20161727
Sequence CCTGCTTCTCTTCAGACACACTT ACACACTTAATTTAGCCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 298} {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!