ID: 1105422303_1105422313

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1105422303 1105422313
Species Human (GRCh38) Human (GRCh38)
Location 13:20264009-20264031 13:20264032-20264054
Sequence CCCTCTGCCCAGTGGTCCCCTGG GCTCCCCTTGCCTTTCCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 325} {0: 1, 1: 0, 2: 3, 3: 42, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!