ID: 1105443794_1105443803

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1105443794 1105443803
Species Human (GRCh38) Human (GRCh38)
Location 13:20435849-20435871 13:20435880-20435902
Sequence CCGACAGCGCCCTCGCGGGAGGC TGGGGCCTCTTGCCAGCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 81} {0: 1, 1: 0, 2: 5, 3: 37, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!