ID: 1105454237_1105454251

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1105454237 1105454251
Species Human (GRCh38) Human (GRCh38)
Location 13:20525767-20525789 13:20525806-20525828
Sequence CCACGCAGCCGGCCGCGGAGGAC GGACGCGGCGCCGCGGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 104} {0: 1, 1: 0, 2: 9, 3: 58, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!