ID: 1105464613_1105464618

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1105464613 1105464618
Species Human (GRCh38) Human (GRCh38)
Location 13:20626639-20626661 13:20626665-20626687
Sequence CCGCAGATCTCTCACTGGCACTG CTCTCTTGCTAGCTTGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 240} {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!