ID: 1105466558_1105466560

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1105466558 1105466560
Species Human (GRCh38) Human (GRCh38)
Location 13:20647643-20647665 13:20647696-20647718
Sequence CCATTCTTCAGCAGCATTAGGTA TATTATAAGACACCATCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140} {0: 1, 1: 0, 2: 1, 3: 19, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!