ID: 1105500877_1105500888

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1105500877 1105500888
Species Human (GRCh38) Human (GRCh38)
Location 13:20970733-20970755 13:20970764-20970786
Sequence CCCCATTCCTAACAGGCCATGGA AGTCAGTAGCCTGGGTGTTGGGG
Strand - +
Off-target summary {0: 9, 1: 47, 2: 445, 3: 905, 4: 1507} {0: 1, 1: 0, 2: 4, 3: 93, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!