ID: 1105502862_1105502876

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1105502862 1105502876
Species Human (GRCh38) Human (GRCh38)
Location 13:20988293-20988315 13:20988331-20988353
Sequence CCGCCCAGCGCCAGGGCATGCTC GCCCTCCGCAGCCGGGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 256} {0: 1, 1: 0, 2: 2, 3: 23, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!