ID: 1105503070_1105503079

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1105503070 1105503079
Species Human (GRCh38) Human (GRCh38)
Location 13:20989032-20989054 13:20989068-20989090
Sequence CCTGCAGCGGGAAGTGTGCCCCT TGGCACCGTAGCCCTTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131} {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!