ID: 1105503083_1105503098

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1105503083 1105503098
Species Human (GRCh38) Human (GRCh38)
Location 13:20989080-20989102 13:20989116-20989138
Sequence CCTTGGGTGGGTGCTGGTGCTGG GGGGGCCGACTCCGGGGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 640} {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!