ID: 1105533479_1105533483

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1105533479 1105533483
Species Human (GRCh38) Human (GRCh38)
Location 13:21242326-21242348 13:21242349-21242371
Sequence CCTTTGAGAGGCGCAGGCTATGT CCTCTTGCCTTGAAAATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 75} {0: 2, 1: 0, 2: 3, 3: 19, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!