ID: 1105534836_1105534842

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1105534836 1105534842
Species Human (GRCh38) Human (GRCh38)
Location 13:21256291-21256313 13:21256340-21256362
Sequence CCCAACCTGCAGAGGCAGGACAC TCCCTCTTCAGCATTAACAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 186} {0: 1, 1: 0, 2: 0, 3: 6, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!