ID: 1105541333_1105541338

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1105541333 1105541338
Species Human (GRCh38) Human (GRCh38)
Location 13:21319761-21319783 13:21319814-21319836
Sequence CCTGCCAGGTGCGGGCCACAGGC AAGCGGATCAAGAAGCAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 270} {0: 1, 1: 1, 2: 0, 3: 19, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!