ID: 1105542586_1105542592

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1105542586 1105542592
Species Human (GRCh38) Human (GRCh38)
Location 13:21327809-21327831 13:21327835-21327857
Sequence CCCAGGAGCCTGGGGTGTCAGTG CGGTAGTGTCTTTGTAGTGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 145, 4: 4267} {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!