ID: 1105567126_1105567130

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1105567126 1105567130
Species Human (GRCh38) Human (GRCh38)
Location 13:21560680-21560702 13:21560701-21560723
Sequence CCCATTGGGATTATTGCAATTAC ACACTGAATTTATAGATTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128} {0: 1, 1: 0, 2: 2, 3: 24, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!