ID: 1105600023_1105600034

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1105600023 1105600034
Species Human (GRCh38) Human (GRCh38)
Location 13:21878504-21878526 13:21878549-21878571
Sequence CCCTATGCCCCTCAGTCACACTG CTGAACCCAGCTGGCTCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 106, 4: 326} {0: 1, 1: 0, 2: 1, 3: 12, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!