ID: 1105606766_1105606774

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105606766 1105606774
Species Human (GRCh38) Human (GRCh38)
Location 13:21932490-21932512 13:21932530-21932552
Sequence CCCTCGAAGGTAGTTGCTCTGGC CAGAGGCCACCTCCCTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48} {0: 1, 1: 0, 2: 11, 3: 78, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!