ID: 1105626964_1105626967

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105626964 1105626967
Species Human (GRCh38) Human (GRCh38)
Location 13:22122007-22122029 13:22122022-22122044
Sequence CCTGAACAGCCCAAAGGGAAGAT GGGAAGATTCTCTCTGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162} {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!