ID: 1105627503_1105627510

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1105627503 1105627510
Species Human (GRCh38) Human (GRCh38)
Location 13:22127056-22127078 13:22127084-22127106
Sequence CCATCCCAGAAAGCCTTCGAGGA CTCGAAAGTGGCAGGTATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135} {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!