ID: 1105629879_1105629886

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1105629879 1105629886
Species Human (GRCh38) Human (GRCh38)
Location 13:22152556-22152578 13:22152593-22152615
Sequence CCCTCCCTCTCCTAGAGGGACAA AGAAAAGTCACAGATATTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 216} {0: 1, 1: 0, 2: 1, 3: 49, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!