ID: 1105633753_1105633757

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105633753 1105633757
Species Human (GRCh38) Human (GRCh38)
Location 13:22197470-22197492 13:22197485-22197507
Sequence CCAGTGGATATACAGCATTATGA CATTATGAAAAGGTGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125} {0: 1, 1: 0, 2: 0, 3: 21, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!